mouse il 1 beta Search Results


96
R&D Systems immunoassay
Immunoassay, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/immunoassay/product/R&D Systems
Average 96 stars, based on 1 article reviews
immunoassay - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

94
MedChemExpress recombinant mouse il 1β
Recombinant Mouse Il 1β, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant mouse il 1β/product/MedChemExpress
Average 94 stars, based on 1 article reviews
recombinant mouse il 1β - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

96
Boster Bio ek0394 mouse ccl2 elisa kit boster
Figure 1. Identification of linc-AAM in Activated Macrophages (A) Quantitative real-time PCR verification of top six upregulated lncRNAs in RAW264.7 cells treated with medium (control [Ctrl]) or AEPS (50 mg/mL) for 1 h (n = 3). (B) Quantitative real-time PCR analysis of linc-AAM, COX-2, IL-1b, IL-6, IL-10, TNF-a, <t>CCL2,</t> CCL5, and CCL22 in RAW264.7 cells treated with AEPS (50 mg/mL) for different times (n = 3). (C) The RACE analysis of linc-AAM using total RNA extracted from RAW264.7 cells treated by AEPS (50 mg/mL) for 1 h. (D) Northern blotting of linc-AAM in RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA served as a loading control. The images shown are representative of three independent experiments. (E and F) Electrophoretogram (E) and quantitative real-time PCR analysis (F) of linc-AAM in cytoplasm and nuclei of RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h (n = 3). (G) linc-AAM (red) was detected in RAW264.7 cells by RNA fluorescence in situ hybridization (FISH). Nuclei (blue) were counterstained with DAPI. Scale bars, 10 mm. (H) Identification of coding capability of linc-AAM using in vitro transcription and translation system. Full-length linc-AAM was cloned into the eukaryotic expression vector pcDNA3.1() with N-terminal start codon ATG and C-terminal FLAG tag in all three coding patterns, and these plasmids were subsequently transfected into HEK293T cells, respectively. Immunoblotting was used to detect the FLAG-tagged protein. STAT3 with FLAG tag severs as a positive control. The images shown were representative of three independent experiments. (I) Quantitative real-time PCR analysis of linc-AAM in different tissues from six C57BL/6 mice per group, male and female in half. (J) Quantitative real-time PCR analysis of linc-AAM in RAW264.7 cells, BMDMs, PMs, and BMDCs treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h (n = 3). (K) Quantitative real-time PCR analysis of linc-AAM and IL-1b in BMDMs treated with AEPS (50 mg/mL) for different times (n = 3). (L) Quantitative real-time PCR analysis of linc-AAM, IL-1b, and COX-2 in RAW264.7 cells stimulated with AEPS (50 mg/mL), LPS (100 ng/mL), poly(I:C) (50 mg/mL), Alum (200 mg/mL), or Quil A (20 mg/mL) for 1 or 4 h, respectively (n = 3). Data are presented as mean ± SEM. ***p < 0.001. See also Figure S1.
Ek0394 Mouse Ccl2 Elisa Kit Boster, supplied by Boster Bio, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ek0394 mouse ccl2 elisa kit boster/product/Boster Bio
Average 96 stars, based on 1 article reviews
ek0394 mouse ccl2 elisa kit boster - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

93
R&D Systems il 1β antibody
Figure 1. Identification of linc-AAM in Activated Macrophages (A) Quantitative real-time PCR verification of top six upregulated lncRNAs in RAW264.7 cells treated with medium (control [Ctrl]) or AEPS (50 mg/mL) for 1 h (n = 3). (B) Quantitative real-time PCR analysis of linc-AAM, COX-2, IL-1b, IL-6, IL-10, TNF-a, <t>CCL2,</t> CCL5, and CCL22 in RAW264.7 cells treated with AEPS (50 mg/mL) for different times (n = 3). (C) The RACE analysis of linc-AAM using total RNA extracted from RAW264.7 cells treated by AEPS (50 mg/mL) for 1 h. (D) Northern blotting of linc-AAM in RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA served as a loading control. The images shown are representative of three independent experiments. (E and F) Electrophoretogram (E) and quantitative real-time PCR analysis (F) of linc-AAM in cytoplasm and nuclei of RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h (n = 3). (G) linc-AAM (red) was detected in RAW264.7 cells by RNA fluorescence in situ hybridization (FISH). Nuclei (blue) were counterstained with DAPI. Scale bars, 10 mm. (H) Identification of coding capability of linc-AAM using in vitro transcription and translation system. Full-length linc-AAM was cloned into the eukaryotic expression vector pcDNA3.1() with N-terminal start codon ATG and C-terminal FLAG tag in all three coding patterns, and these plasmids were subsequently transfected into HEK293T cells, respectively. Immunoblotting was used to detect the FLAG-tagged protein. STAT3 with FLAG tag severs as a positive control. The images shown were representative of three independent experiments. (I) Quantitative real-time PCR analysis of linc-AAM in different tissues from six C57BL/6 mice per group, male and female in half. (J) Quantitative real-time PCR analysis of linc-AAM in RAW264.7 cells, BMDMs, PMs, and BMDCs treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h (n = 3). (K) Quantitative real-time PCR analysis of linc-AAM and IL-1b in BMDMs treated with AEPS (50 mg/mL) for different times (n = 3). (L) Quantitative real-time PCR analysis of linc-AAM, IL-1b, and COX-2 in RAW264.7 cells stimulated with AEPS (50 mg/mL), LPS (100 ng/mL), poly(I:C) (50 mg/mL), Alum (200 mg/mL), or Quil A (20 mg/mL) for 1 or 4 h, respectively (n = 3). Data are presented as mean ± SEM. ***p < 0.001. See also Figure S1.
Il 1β Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/il 1β antibody/product/R&D Systems
Average 93 stars, based on 1 article reviews
il 1β antibody - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

96
Proteintech il 1β
Figure 1. Identification of linc-AAM in Activated Macrophages (A) Quantitative real-time PCR verification of top six upregulated lncRNAs in RAW264.7 cells treated with medium (control [Ctrl]) or AEPS (50 mg/mL) for 1 h (n = 3). (B) Quantitative real-time PCR analysis of linc-AAM, COX-2, IL-1b, IL-6, IL-10, TNF-a, <t>CCL2,</t> CCL5, and CCL22 in RAW264.7 cells treated with AEPS (50 mg/mL) for different times (n = 3). (C) The RACE analysis of linc-AAM using total RNA extracted from RAW264.7 cells treated by AEPS (50 mg/mL) for 1 h. (D) Northern blotting of linc-AAM in RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA served as a loading control. The images shown are representative of three independent experiments. (E and F) Electrophoretogram (E) and quantitative real-time PCR analysis (F) of linc-AAM in cytoplasm and nuclei of RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h (n = 3). (G) linc-AAM (red) was detected in RAW264.7 cells by RNA fluorescence in situ hybridization (FISH). Nuclei (blue) were counterstained with DAPI. Scale bars, 10 mm. (H) Identification of coding capability of linc-AAM using in vitro transcription and translation system. Full-length linc-AAM was cloned into the eukaryotic expression vector pcDNA3.1() with N-terminal start codon ATG and C-terminal FLAG tag in all three coding patterns, and these plasmids were subsequently transfected into HEK293T cells, respectively. Immunoblotting was used to detect the FLAG-tagged protein. STAT3 with FLAG tag severs as a positive control. The images shown were representative of three independent experiments. (I) Quantitative real-time PCR analysis of linc-AAM in different tissues from six C57BL/6 mice per group, male and female in half. (J) Quantitative real-time PCR analysis of linc-AAM in RAW264.7 cells, BMDMs, PMs, and BMDCs treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h (n = 3). (K) Quantitative real-time PCR analysis of linc-AAM and IL-1b in BMDMs treated with AEPS (50 mg/mL) for different times (n = 3). (L) Quantitative real-time PCR analysis of linc-AAM, IL-1b, and COX-2 in RAW264.7 cells stimulated with AEPS (50 mg/mL), LPS (100 ng/mL), poly(I:C) (50 mg/mL), Alum (200 mg/mL), or Quil A (20 mg/mL) for 1 or 4 h, respectively (n = 3). Data are presented as mean ± SEM. ***p < 0.001. See also Figure S1.
Il 1β, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/il 1β/product/Proteintech
Average 96 stars, based on 1 article reviews
il 1β - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

96
R&D Systems il 1β
Figure 1. Identification of linc-AAM in Activated Macrophages (A) Quantitative real-time PCR verification of top six upregulated lncRNAs in RAW264.7 cells treated with medium (control [Ctrl]) or AEPS (50 mg/mL) for 1 h (n = 3). (B) Quantitative real-time PCR analysis of linc-AAM, COX-2, IL-1b, IL-6, IL-10, TNF-a, <t>CCL2,</t> CCL5, and CCL22 in RAW264.7 cells treated with AEPS (50 mg/mL) for different times (n = 3). (C) The RACE analysis of linc-AAM using total RNA extracted from RAW264.7 cells treated by AEPS (50 mg/mL) for 1 h. (D) Northern blotting of linc-AAM in RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA served as a loading control. The images shown are representative of three independent experiments. (E and F) Electrophoretogram (E) and quantitative real-time PCR analysis (F) of linc-AAM in cytoplasm and nuclei of RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h (n = 3). (G) linc-AAM (red) was detected in RAW264.7 cells by RNA fluorescence in situ hybridization (FISH). Nuclei (blue) were counterstained with DAPI. Scale bars, 10 mm. (H) Identification of coding capability of linc-AAM using in vitro transcription and translation system. Full-length linc-AAM was cloned into the eukaryotic expression vector pcDNA3.1() with N-terminal start codon ATG and C-terminal FLAG tag in all three coding patterns, and these plasmids were subsequently transfected into HEK293T cells, respectively. Immunoblotting was used to detect the FLAG-tagged protein. STAT3 with FLAG tag severs as a positive control. The images shown were representative of three independent experiments. (I) Quantitative real-time PCR analysis of linc-AAM in different tissues from six C57BL/6 mice per group, male and female in half. (J) Quantitative real-time PCR analysis of linc-AAM in RAW264.7 cells, BMDMs, PMs, and BMDCs treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h (n = 3). (K) Quantitative real-time PCR analysis of linc-AAM and IL-1b in BMDMs treated with AEPS (50 mg/mL) for different times (n = 3). (L) Quantitative real-time PCR analysis of linc-AAM, IL-1b, and COX-2 in RAW264.7 cells stimulated with AEPS (50 mg/mL), LPS (100 ng/mL), poly(I:C) (50 mg/mL), Alum (200 mg/mL), or Quil A (20 mg/mL) for 1 or 4 h, respectively (n = 3). Data are presented as mean ± SEM. ***p < 0.001. See also Figure S1.
Il 1β, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/il 1β/product/R&D Systems
Average 96 stars, based on 1 article reviews
il 1β - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

96
R&D Systems mouse il 1β recombinant protein
Figure 1. Identification of linc-AAM in Activated Macrophages (A) Quantitative real-time PCR verification of top six upregulated lncRNAs in RAW264.7 cells treated with medium (control [Ctrl]) or AEPS (50 mg/mL) for 1 h (n = 3). (B) Quantitative real-time PCR analysis of linc-AAM, COX-2, IL-1b, IL-6, IL-10, TNF-a, <t>CCL2,</t> CCL5, and CCL22 in RAW264.7 cells treated with AEPS (50 mg/mL) for different times (n = 3). (C) The RACE analysis of linc-AAM using total RNA extracted from RAW264.7 cells treated by AEPS (50 mg/mL) for 1 h. (D) Northern blotting of linc-AAM in RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA served as a loading control. The images shown are representative of three independent experiments. (E and F) Electrophoretogram (E) and quantitative real-time PCR analysis (F) of linc-AAM in cytoplasm and nuclei of RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h (n = 3). (G) linc-AAM (red) was detected in RAW264.7 cells by RNA fluorescence in situ hybridization (FISH). Nuclei (blue) were counterstained with DAPI. Scale bars, 10 mm. (H) Identification of coding capability of linc-AAM using in vitro transcription and translation system. Full-length linc-AAM was cloned into the eukaryotic expression vector pcDNA3.1() with N-terminal start codon ATG and C-terminal FLAG tag in all three coding patterns, and these plasmids were subsequently transfected into HEK293T cells, respectively. Immunoblotting was used to detect the FLAG-tagged protein. STAT3 with FLAG tag severs as a positive control. The images shown were representative of three independent experiments. (I) Quantitative real-time PCR analysis of linc-AAM in different tissues from six C57BL/6 mice per group, male and female in half. (J) Quantitative real-time PCR analysis of linc-AAM in RAW264.7 cells, BMDMs, PMs, and BMDCs treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h (n = 3). (K) Quantitative real-time PCR analysis of linc-AAM and IL-1b in BMDMs treated with AEPS (50 mg/mL) for different times (n = 3). (L) Quantitative real-time PCR analysis of linc-AAM, IL-1b, and COX-2 in RAW264.7 cells stimulated with AEPS (50 mg/mL), LPS (100 ng/mL), poly(I:C) (50 mg/mL), Alum (200 mg/mL), or Quil A (20 mg/mL) for 1 or 4 h, respectively (n = 3). Data are presented as mean ± SEM. ***p < 0.001. See also Figure S1.
Mouse Il 1β Recombinant Protein, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse il 1β recombinant protein/product/R&D Systems
Average 96 stars, based on 1 article reviews
mouse il 1β recombinant protein - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

93
Bio-Rad human il 1β ab
Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f <t>),</t> <t>IL-1β</t> + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse <t>IgG1,</t> clone <t>#2E8,</t> 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references
Human Il 1β Ab, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human il 1β ab/product/Bio-Rad
Average 93 stars, based on 1 article reviews
human il 1β ab - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

96
R&D Systems r d systems cn mlb00c
Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f <t>),</t> <t>IL-1β</t> + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse <t>IgG1,</t> clone <t>#2E8,</t> 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references
R D Systems Cn Mlb00c, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/r d systems cn mlb00c/product/R&D Systems
Average 96 stars, based on 1 article reviews
r d systems cn mlb00c - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

94
R&D Systems il 1β elisa
Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f <t>),</t> <t>IL-1β</t> + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse <t>IgG1,</t> clone <t>#2E8,</t> 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references
Il 1β Elisa, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/il 1β elisa/product/R&D Systems
Average 94 stars, based on 1 article reviews
il 1β elisa - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

98
R&D Systems anti il 1β
Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f <t>),</t> <t>IL-1β</t> + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse <t>IgG1,</t> clone <t>#2E8,</t> 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references
Anti Il 1β, supplied by R&D Systems, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti il 1β/product/R&D Systems
Average 98 stars, based on 1 article reviews
anti il 1β - by Bioz Stars, 2026-03
98/100 stars
  Buy from Supplier

96
R&D Systems recombinant mouse il 1 beta il 1f2 protein
Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f <t>),</t> <t>IL-1β</t> + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse <t>IgG1,</t> clone <t>#2E8,</t> 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references
Recombinant Mouse Il 1 Beta Il 1f2 Protein, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant mouse il 1 beta il 1f2 protein/product/R&D Systems
Average 96 stars, based on 1 article reviews
recombinant mouse il 1 beta il 1f2 protein - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

Image Search Results


Figure 1. Identification of linc-AAM in Activated Macrophages (A) Quantitative real-time PCR verification of top six upregulated lncRNAs in RAW264.7 cells treated with medium (control [Ctrl]) or AEPS (50 mg/mL) for 1 h (n = 3). (B) Quantitative real-time PCR analysis of linc-AAM, COX-2, IL-1b, IL-6, IL-10, TNF-a, CCL2, CCL5, and CCL22 in RAW264.7 cells treated with AEPS (50 mg/mL) for different times (n = 3). (C) The RACE analysis of linc-AAM using total RNA extracted from RAW264.7 cells treated by AEPS (50 mg/mL) for 1 h. (D) Northern blotting of linc-AAM in RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA served as a loading control. The images shown are representative of three independent experiments. (E and F) Electrophoretogram (E) and quantitative real-time PCR analysis (F) of linc-AAM in cytoplasm and nuclei of RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h (n = 3). (G) linc-AAM (red) was detected in RAW264.7 cells by RNA fluorescence in situ hybridization (FISH). Nuclei (blue) were counterstained with DAPI. Scale bars, 10 mm. (H) Identification of coding capability of linc-AAM using in vitro transcription and translation system. Full-length linc-AAM was cloned into the eukaryotic expression vector pcDNA3.1() with N-terminal start codon ATG and C-terminal FLAG tag in all three coding patterns, and these plasmids were subsequently transfected into HEK293T cells, respectively. Immunoblotting was used to detect the FLAG-tagged protein. STAT3 with FLAG tag severs as a positive control. The images shown were representative of three independent experiments. (I) Quantitative real-time PCR analysis of linc-AAM in different tissues from six C57BL/6 mice per group, male and female in half. (J) Quantitative real-time PCR analysis of linc-AAM in RAW264.7 cells, BMDMs, PMs, and BMDCs treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h (n = 3). (K) Quantitative real-time PCR analysis of linc-AAM and IL-1b in BMDMs treated with AEPS (50 mg/mL) for different times (n = 3). (L) Quantitative real-time PCR analysis of linc-AAM, IL-1b, and COX-2 in RAW264.7 cells stimulated with AEPS (50 mg/mL), LPS (100 ng/mL), poly(I:C) (50 mg/mL), Alum (200 mg/mL), or Quil A (20 mg/mL) for 1 or 4 h, respectively (n = 3). Data are presented as mean ± SEM. ***p < 0.001. See also Figure S1.

Journal: Cell reports

Article Title: linc-AAM Facilitates Gene Expression Contributing to Macrophage Activation and Adaptive Immune Responses.

doi: 10.1016/j.celrep.2020.108584

Figure Lengend Snippet: Figure 1. Identification of linc-AAM in Activated Macrophages (A) Quantitative real-time PCR verification of top six upregulated lncRNAs in RAW264.7 cells treated with medium (control [Ctrl]) or AEPS (50 mg/mL) for 1 h (n = 3). (B) Quantitative real-time PCR analysis of linc-AAM, COX-2, IL-1b, IL-6, IL-10, TNF-a, CCL2, CCL5, and CCL22 in RAW264.7 cells treated with AEPS (50 mg/mL) for different times (n = 3). (C) The RACE analysis of linc-AAM using total RNA extracted from RAW264.7 cells treated by AEPS (50 mg/mL) for 1 h. (D) Northern blotting of linc-AAM in RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA served as a loading control. The images shown are representative of three independent experiments. (E and F) Electrophoretogram (E) and quantitative real-time PCR analysis (F) of linc-AAM in cytoplasm and nuclei of RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h (n = 3). (G) linc-AAM (red) was detected in RAW264.7 cells by RNA fluorescence in situ hybridization (FISH). Nuclei (blue) were counterstained with DAPI. Scale bars, 10 mm. (H) Identification of coding capability of linc-AAM using in vitro transcription and translation system. Full-length linc-AAM was cloned into the eukaryotic expression vector pcDNA3.1() with N-terminal start codon ATG and C-terminal FLAG tag in all three coding patterns, and these plasmids were subsequently transfected into HEK293T cells, respectively. Immunoblotting was used to detect the FLAG-tagged protein. STAT3 with FLAG tag severs as a positive control. The images shown were representative of three independent experiments. (I) Quantitative real-time PCR analysis of linc-AAM in different tissues from six C57BL/6 mice per group, male and female in half. (J) Quantitative real-time PCR analysis of linc-AAM in RAW264.7 cells, BMDMs, PMs, and BMDCs treated with medium (Ctrl) or AEPS (50 mg/mL) for 1 h (n = 3). (K) Quantitative real-time PCR analysis of linc-AAM and IL-1b in BMDMs treated with AEPS (50 mg/mL) for different times (n = 3). (L) Quantitative real-time PCR analysis of linc-AAM, IL-1b, and COX-2 in RAW264.7 cells stimulated with AEPS (50 mg/mL), LPS (100 ng/mL), poly(I:C) (50 mg/mL), Alum (200 mg/mL), or Quil A (20 mg/mL) for 1 or 4 h, respectively (n = 3). Data are presented as mean ± SEM. ***p < 0.001. See also Figure S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Pyrrolidinedithiocarbamate ammonium (PDTC) Beyotime Cat# S1808 Red blood cell lysis buffer Beyotime C3702 Enhanced chemiluminescence (ECL) kit Beyotime P0018AS Proteinase K Beyotime Cat# ST533 Radioimmunoprecipitation (RIPA) buffer Beyotime Cat# P0013B TRIzol reagent Ambion Cat# 15596026 Lipofectamine 3000 Invitrogen Cat# L3000015 Lipofectamine LTX reagent with PLUS reagent Invitrogen Cat# 15338100 Rela (Myc-DDK-tagged)-pCMV6 OriGene Cat# MR227671 Stat3 (Myc-DDK-tagged)-pCMV6 OriGene Cat# MR227265 pCMV6-Entry OriGene Cat# PS100001 PrimeSTAR max DNA polymerase Takara Cat# R045A pLXSN retroviral Vector Clontech Cat# 631509 pcDNA3.1(-) eukaryotic expression vector Invitrogen Cat# V79520 pGL3-Basic Vector Promega Cat# E1751 Stat3 shRNA(m) lentiviral particles Santa Cruz Cat# sc-29494-V NF-kB p65 shRNA(m) lentiviral particles Santa Cruz Cat# sc-29411-V Control shRNA(m) lentiviral particles Santa Cruz Cat# sc-108080 G418 sulfate BBI Cat# A600958-0001 Puromycin InvivoGen Cat# ANT-PR Blasticidin InvivoGen Cat# ant-bl-05 FastStart Universal SYBR Green Master (Rox) Roche Cat# 4913850001 CSPD Roche Cat#11655884001 Anti-digoxigenin AP-conjungate Roche Cat#11093274910 Ribonucleoside vanadyl complex New England BioLabs Cat# S1402S MyOne T1 streptavidin beads Invitrogen Cat# 65604D Albumin from chicken egg white Sigma-Aldrich Cat# A5503 Concanavalin A Sigma-Aldrich Cat# L6397 Critical Commercial Assays Mouse IL-10 ELISA kit Boster Cat# EK0417 Mouse TNF-a ELISA kit Boster Cat# EK0527 Mouse IL-1b ELISA kit Boster Cat# EK0394 Mouse CCL2 ELISA kit Boster Cat# EK0568 Mouse IL-6 ELISA kit Boster Cat# EK0411 Mouse tail direct PCR Kit Bimake Cat# B40013 BLOCK-iT Pol II miR RNAi Expression Vector Kits with EmGFP Invitrogen Cat# K4936-00 Maxima First Strand cDNA Synthesis Kit Thermo Fisher Cat# K1671 NorthernMax Gly Kit Ambion Cat# AM1946 PrimeScript RT reagent Kit with gDNA Eraser Takara Cat# RR047A SMARTer RACE kit Clontech Cat# 634858 Dual-Luciferase Reporter Assay System Promega Cat# E1910 MEGAscript T7 Transcription Kit Ambion Cat# AM1333 Pierce RNA 30 End Desthiobiotinylation Kit Thermo Scientific Cat# 20163 PierceMagnetic RNA-Protein Pull-Down Kit Thermo Scientific Cat# 20164 (Continued on next page) Cell Reports 34, 108584, January 5, 2021 e2

Techniques: Real-time Polymerase Chain Reaction, Control, Northern Blot, In Situ Hybridization, In Vitro, Clone Assay, Expressing, Plasmid Preparation, FLAG-tag, Transfection, Western Blot, Positive Control

Figure 2. linc-AAM Silencing or Knockout (KO) Inhibits Macrophage Activation and the Expression of IRGs in Vitro and ex Vivo (A) Heatmap of differentially expressed genes in linc-AAM-RNAi RAW264.7 cells (linc-AAM KD) relative to Ctrl-RNAi cells (Scramble) treated with AEPS for 4 h. The most downregulated genes in linc-AAM KD cells compared with Scramble cells are magnified into view. (B) Quantitative real-time PCR analysis of linc-AAM, COX-2, IL-1b, IL-10, TNF-a, CCL2, CCL3, CCL4, CCL5, and CCL22 in linc-AAM KD and Scramble RAW264.7 cells treated with AEPS (50 mg/mL) for 4 h (n = 3). (C) The production of IL-1b and IL-6 from linc-AAM KD and Scramble RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 24 h using ELISA (n = 3). nd, not detectable. (D) Western bolt analysis of COX-2 in linc-AAM KD and Scramble RAW264.7 cells treated with AEPS (50 mg/mL) for 12 and 24 h. (E) Fluorescence-activated cell sorting (FACS) analysis of surface molecules (Ly6G, CD40, CD80, CD86, MHC I, and MHC II) in linc-AAM KD and Scramble RAW264.7 cells treated with AEPS (50 mg/mL) for 24 h (n = 3). (F) Quantitative real-time PCR analysis of linc-AAM potential target genes IL-1b, IL-6, COX-2, TNF-a, CCL2, and CXCL10 in BMDMs from WT and linc-AAM KO mice treated with medium (untreatment) or AEPS (25 mg/mL) for 4 or 8 h (n = 3). (G) The production of IL-6 and TNF-a in BMDMs from WT and linc-AAM KO mice treated with medium (Ctrl) or AEPS (25 mg/mL) for 24 h using ELISA (n = 3). (H) FACS analysis of surface molecules (CD40, CD80, CD86, MHC I, and MHC II) of BMDMs from WT or linc-AAM KO mice treated with medium (Ctrl) or AEPS (25 mg/mL) for 24 h (n = 3). (I) Quantitative real-time PCR analysis of miR155hg in linc-AAM KD and Scramble RAW264.7 cells treated by AEPS (50 mg/mL) for 4 h. (J) Quantitative real-time PCR analysis of miR155hg in BMDMs from WT and linc-AAM KO mice after treated by AEPS (25 mg/mL) for 4 h. Data are presented as mean ± SEM. *p < 0.05, **p < 0.01, and ***p < 0.001. See also Figures S2 and S3.

Journal: Cell reports

Article Title: linc-AAM Facilitates Gene Expression Contributing to Macrophage Activation and Adaptive Immune Responses.

doi: 10.1016/j.celrep.2020.108584

Figure Lengend Snippet: Figure 2. linc-AAM Silencing or Knockout (KO) Inhibits Macrophage Activation and the Expression of IRGs in Vitro and ex Vivo (A) Heatmap of differentially expressed genes in linc-AAM-RNAi RAW264.7 cells (linc-AAM KD) relative to Ctrl-RNAi cells (Scramble) treated with AEPS for 4 h. The most downregulated genes in linc-AAM KD cells compared with Scramble cells are magnified into view. (B) Quantitative real-time PCR analysis of linc-AAM, COX-2, IL-1b, IL-10, TNF-a, CCL2, CCL3, CCL4, CCL5, and CCL22 in linc-AAM KD and Scramble RAW264.7 cells treated with AEPS (50 mg/mL) for 4 h (n = 3). (C) The production of IL-1b and IL-6 from linc-AAM KD and Scramble RAW264.7 cells treated with medium (Ctrl) or AEPS (50 mg/mL) for 24 h using ELISA (n = 3). nd, not detectable. (D) Western bolt analysis of COX-2 in linc-AAM KD and Scramble RAW264.7 cells treated with AEPS (50 mg/mL) for 12 and 24 h. (E) Fluorescence-activated cell sorting (FACS) analysis of surface molecules (Ly6G, CD40, CD80, CD86, MHC I, and MHC II) in linc-AAM KD and Scramble RAW264.7 cells treated with AEPS (50 mg/mL) for 24 h (n = 3). (F) Quantitative real-time PCR analysis of linc-AAM potential target genes IL-1b, IL-6, COX-2, TNF-a, CCL2, and CXCL10 in BMDMs from WT and linc-AAM KO mice treated with medium (untreatment) or AEPS (25 mg/mL) for 4 or 8 h (n = 3). (G) The production of IL-6 and TNF-a in BMDMs from WT and linc-AAM KO mice treated with medium (Ctrl) or AEPS (25 mg/mL) for 24 h using ELISA (n = 3). (H) FACS analysis of surface molecules (CD40, CD80, CD86, MHC I, and MHC II) of BMDMs from WT or linc-AAM KO mice treated with medium (Ctrl) or AEPS (25 mg/mL) for 24 h (n = 3). (I) Quantitative real-time PCR analysis of miR155hg in linc-AAM KD and Scramble RAW264.7 cells treated by AEPS (50 mg/mL) for 4 h. (J) Quantitative real-time PCR analysis of miR155hg in BMDMs from WT and linc-AAM KO mice after treated by AEPS (25 mg/mL) for 4 h. Data are presented as mean ± SEM. *p < 0.05, **p < 0.01, and ***p < 0.001. See also Figures S2 and S3.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Pyrrolidinedithiocarbamate ammonium (PDTC) Beyotime Cat# S1808 Red blood cell lysis buffer Beyotime C3702 Enhanced chemiluminescence (ECL) kit Beyotime P0018AS Proteinase K Beyotime Cat# ST533 Radioimmunoprecipitation (RIPA) buffer Beyotime Cat# P0013B TRIzol reagent Ambion Cat# 15596026 Lipofectamine 3000 Invitrogen Cat# L3000015 Lipofectamine LTX reagent with PLUS reagent Invitrogen Cat# 15338100 Rela (Myc-DDK-tagged)-pCMV6 OriGene Cat# MR227671 Stat3 (Myc-DDK-tagged)-pCMV6 OriGene Cat# MR227265 pCMV6-Entry OriGene Cat# PS100001 PrimeSTAR max DNA polymerase Takara Cat# R045A pLXSN retroviral Vector Clontech Cat# 631509 pcDNA3.1(-) eukaryotic expression vector Invitrogen Cat# V79520 pGL3-Basic Vector Promega Cat# E1751 Stat3 shRNA(m) lentiviral particles Santa Cruz Cat# sc-29494-V NF-kB p65 shRNA(m) lentiviral particles Santa Cruz Cat# sc-29411-V Control shRNA(m) lentiviral particles Santa Cruz Cat# sc-108080 G418 sulfate BBI Cat# A600958-0001 Puromycin InvivoGen Cat# ANT-PR Blasticidin InvivoGen Cat# ant-bl-05 FastStart Universal SYBR Green Master (Rox) Roche Cat# 4913850001 CSPD Roche Cat#11655884001 Anti-digoxigenin AP-conjungate Roche Cat#11093274910 Ribonucleoside vanadyl complex New England BioLabs Cat# S1402S MyOne T1 streptavidin beads Invitrogen Cat# 65604D Albumin from chicken egg white Sigma-Aldrich Cat# A5503 Concanavalin A Sigma-Aldrich Cat# L6397 Critical Commercial Assays Mouse IL-10 ELISA kit Boster Cat# EK0417 Mouse TNF-a ELISA kit Boster Cat# EK0527 Mouse IL-1b ELISA kit Boster Cat# EK0394 Mouse CCL2 ELISA kit Boster Cat# EK0568 Mouse IL-6 ELISA kit Boster Cat# EK0411 Mouse tail direct PCR Kit Bimake Cat# B40013 BLOCK-iT Pol II miR RNAi Expression Vector Kits with EmGFP Invitrogen Cat# K4936-00 Maxima First Strand cDNA Synthesis Kit Thermo Fisher Cat# K1671 NorthernMax Gly Kit Ambion Cat# AM1946 PrimeScript RT reagent Kit with gDNA Eraser Takara Cat# RR047A SMARTer RACE kit Clontech Cat# 634858 Dual-Luciferase Reporter Assay System Promega Cat# E1910 MEGAscript T7 Transcription Kit Ambion Cat# AM1333 Pierce RNA 30 End Desthiobiotinylation Kit Thermo Scientific Cat# 20163 PierceMagnetic RNA-Protein Pull-Down Kit Thermo Scientific Cat# 20164 (Continued on next page) Cell Reports 34, 108584, January 5, 2021 e2

Techniques: Knock-Out, Activation Assay, Expressing, In Vitro, Ex Vivo, Real-time Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay, Western Blot, Fluorescence, FACS

Figure 6. linc-AAM Facilitates Chromatin Activation to Promote the Transcription of IRGs (A) Cross-linked RIP to detect linc-AAM association with H3 and H3K4me3. The nuclear lysates of RAW264.7 cells were IPed with control IgG, anti-histone H3, or anti-histone H3K4me3 antibody, and then the complexes were analyzed for the presence of linc-AAM by Quantitative real-time PCR (n = 3). Signals were normalized to 10% input samples. (B) Western blot analysis of histone H3 in RNA pull-down assay samples of linc-AAM and its different mutants as in Figure 5G. (C and D) coIP analysis of the interaction between hnRNPL and histone H3 or H3K4me3 in RAW264.7 cells treated by medium or AEPS for 1 h (n = 3). (E) coIP analysis of the interaction between hnRNPL and histone H3 in BMDMs from WT or linc-AAM KO mice treated by medium or AEPS for 2 h (n = 3). (F) Mouse IL-1b promoter-driven Luc activities in HEK293T cells transfected with linc-AAM overexpression plasmids or empty plasmids (Ctrl). (G) ChIRP enrichment analysis for linc-AAM and control IL-1b. LacZ antisense DNA probes are used as negative controls. (H) linc-AAM ChIRP-qPCR in AEPS-treated RAW264.7 cells. The sequences of primers used in qPCR for CCL2, IL-1b, COX-2, CCL5, TNF-a, CXCL10, IL-6, and GAPDH are within their promoter regions. GAPDH served as a negative control. (I) Integrated model depicting linc-AAM functioning to facilitate inducible expression of IRGs in macrophages. TF, transcription factor. Data are presented as mean ± SEM. **p < 0.01 and ***p < 0.001. See also Figure S6.

Journal: Cell reports

Article Title: linc-AAM Facilitates Gene Expression Contributing to Macrophage Activation and Adaptive Immune Responses.

doi: 10.1016/j.celrep.2020.108584

Figure Lengend Snippet: Figure 6. linc-AAM Facilitates Chromatin Activation to Promote the Transcription of IRGs (A) Cross-linked RIP to detect linc-AAM association with H3 and H3K4me3. The nuclear lysates of RAW264.7 cells were IPed with control IgG, anti-histone H3, or anti-histone H3K4me3 antibody, and then the complexes were analyzed for the presence of linc-AAM by Quantitative real-time PCR (n = 3). Signals were normalized to 10% input samples. (B) Western blot analysis of histone H3 in RNA pull-down assay samples of linc-AAM and its different mutants as in Figure 5G. (C and D) coIP analysis of the interaction between hnRNPL and histone H3 or H3K4me3 in RAW264.7 cells treated by medium or AEPS for 1 h (n = 3). (E) coIP analysis of the interaction between hnRNPL and histone H3 in BMDMs from WT or linc-AAM KO mice treated by medium or AEPS for 2 h (n = 3). (F) Mouse IL-1b promoter-driven Luc activities in HEK293T cells transfected with linc-AAM overexpression plasmids or empty plasmids (Ctrl). (G) ChIRP enrichment analysis for linc-AAM and control IL-1b. LacZ antisense DNA probes are used as negative controls. (H) linc-AAM ChIRP-qPCR in AEPS-treated RAW264.7 cells. The sequences of primers used in qPCR for CCL2, IL-1b, COX-2, CCL5, TNF-a, CXCL10, IL-6, and GAPDH are within their promoter regions. GAPDH served as a negative control. (I) Integrated model depicting linc-AAM functioning to facilitate inducible expression of IRGs in macrophages. TF, transcription factor. Data are presented as mean ± SEM. **p < 0.01 and ***p < 0.001. See also Figure S6.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Pyrrolidinedithiocarbamate ammonium (PDTC) Beyotime Cat# S1808 Red blood cell lysis buffer Beyotime C3702 Enhanced chemiluminescence (ECL) kit Beyotime P0018AS Proteinase K Beyotime Cat# ST533 Radioimmunoprecipitation (RIPA) buffer Beyotime Cat# P0013B TRIzol reagent Ambion Cat# 15596026 Lipofectamine 3000 Invitrogen Cat# L3000015 Lipofectamine LTX reagent with PLUS reagent Invitrogen Cat# 15338100 Rela (Myc-DDK-tagged)-pCMV6 OriGene Cat# MR227671 Stat3 (Myc-DDK-tagged)-pCMV6 OriGene Cat# MR227265 pCMV6-Entry OriGene Cat# PS100001 PrimeSTAR max DNA polymerase Takara Cat# R045A pLXSN retroviral Vector Clontech Cat# 631509 pcDNA3.1(-) eukaryotic expression vector Invitrogen Cat# V79520 pGL3-Basic Vector Promega Cat# E1751 Stat3 shRNA(m) lentiviral particles Santa Cruz Cat# sc-29494-V NF-kB p65 shRNA(m) lentiviral particles Santa Cruz Cat# sc-29411-V Control shRNA(m) lentiviral particles Santa Cruz Cat# sc-108080 G418 sulfate BBI Cat# A600958-0001 Puromycin InvivoGen Cat# ANT-PR Blasticidin InvivoGen Cat# ant-bl-05 FastStart Universal SYBR Green Master (Rox) Roche Cat# 4913850001 CSPD Roche Cat#11655884001 Anti-digoxigenin AP-conjungate Roche Cat#11093274910 Ribonucleoside vanadyl complex New England BioLabs Cat# S1402S MyOne T1 streptavidin beads Invitrogen Cat# 65604D Albumin from chicken egg white Sigma-Aldrich Cat# A5503 Concanavalin A Sigma-Aldrich Cat# L6397 Critical Commercial Assays Mouse IL-10 ELISA kit Boster Cat# EK0417 Mouse TNF-a ELISA kit Boster Cat# EK0527 Mouse IL-1b ELISA kit Boster Cat# EK0394 Mouse CCL2 ELISA kit Boster Cat# EK0568 Mouse IL-6 ELISA kit Boster Cat# EK0411 Mouse tail direct PCR Kit Bimake Cat# B40013 BLOCK-iT Pol II miR RNAi Expression Vector Kits with EmGFP Invitrogen Cat# K4936-00 Maxima First Strand cDNA Synthesis Kit Thermo Fisher Cat# K1671 NorthernMax Gly Kit Ambion Cat# AM1946 PrimeScript RT reagent Kit with gDNA Eraser Takara Cat# RR047A SMARTer RACE kit Clontech Cat# 634858 Dual-Luciferase Reporter Assay System Promega Cat# E1910 MEGAscript T7 Transcription Kit Ambion Cat# AM1333 Pierce RNA 30 End Desthiobiotinylation Kit Thermo Scientific Cat# 20163 PierceMagnetic RNA-Protein Pull-Down Kit Thermo Scientific Cat# 20164 (Continued on next page) Cell Reports 34, 108584, January 5, 2021 e2

Techniques: Activation Assay, Control, Real-time Polymerase Chain Reaction, Western Blot, Pull Down Assay, Transfection, Over Expression, Negative Control, Expressing

Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f ), IL-1β + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f ), IL-1β + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Immunohistochemical staining, Staining, Immunofluorescence, Double Staining, Marker

Studies on anti-cytokine treatments in experimental and human stroke

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Studies on anti-cytokine treatments in experimental and human stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Injection, Functional Assay, Recombinant, Plasmid Preparation, Clinical Proteomics, Infection

Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Bioprocessing, Dominant Negative Mutation, Recombinant

Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [ , ], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as . The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from . IL-6, IL-6R, and gp130 mRNA data have been obtained from . Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LT α lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [ , ], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as . The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from . IL-6, IL-6R, and gp130 mRNA data have been obtained from . Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LT α lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Sequencing

Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. a – c TNF ( a ), IL-1 ( b ), and IL-6 ( c ) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database ( www.proteinlounge.com ). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. a – c TNF ( a ), IL-1 ( b ), and IL-6 ( c ) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database ( www.proteinlounge.com ). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Modification